Mature sequence mmu-miR-3569-5p

Accession numberMIMAT0029854
IDmmu-miR-3569-5p
Stem-Loop mmu-mir-3569
Sequence
ucggaggagagcagaccggug
Get sequence
Deep sequencing81 reads, 31 experiments
Predicted targets

References

1