Mature sequence mmu-miR-3569-3p

Accession numberMIMAT0029855
IDmmu-miR-3569-3p
Stem-Loop mmu-mir-3569
Sequence
ucagucugcgcuccucuccagc
Get sequence
Deep sequencing15 reads, 14 experiments
Predicted targets

References

1