Mature sequence mmu-miR-290b-5p

Accession numberMIMAT0029900
IDmmu-miR-290b-5p
Stem-Loop mmu-mir-290b
Sequence
gcuuaaaacuaggcggcacuuu
Get sequence
Deep sequencing28 reads, 5 experiments
Predicted targets

References

1