Mature sequence bta-miR-2285z

Accession numberMIMAT0029950
IDbta-miR-2285z
Stem-Loop bta-mir-2285z
Sequence
ccagaaaguucauucagguccu
Get sequence
Deep sequencing51 reads, 26 experiments
Predicted targets

References

1