Mature sequence bta-miR-2285z

• Accession number: MIMAT0029950
• ID: bta-miR-2285z
• Stem-Loop: bta-mir-2285z
• Sequence: ccagaaaguucauucagguccu
• Deep sequencing: 51 reads, 26 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-2285z

References

1. PMID:23100578 "Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing" Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K J Anim Sci. 91:90-103(2013).