Mature sequence bdi-miR7784a-3p

Accession numberMIMAT0030323
IDbdi-miR7784a-3p
Stem-Loop bdi-MIR7784a
Sequence
cauagacuuaugagacgaguacau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).