Mature sequence hhi-let-7j

Accession numberMIMAT0030346
IDhhi-let-7j
Stem-Loop hhi-let-7j
Sequence
ugagguaguuguuuguacaguu
Get sequence
Deep sequencing reads, experiments

References

1