Mature sequence hhi-miR-199a

Accession numberMIMAT0030358
IDhhi-miR-199a
Stem-Loop hhi-mir-199a
Sequence
cccaguguucagacuaccuguuc
Get sequence
Deep sequencing reads, experiments

References

1