Mature sequence rno-miR-155-5p

Accession numberMIMAT0030409
IDrno-miR-155-5p
Stem-Loop rno-mir-155
Sequence
uuaaugcuaauugugauaggggu
Get sequence
Deep sequencing19977 reads, 480 experiments
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).