Mature sequence bta-miR-2284ab

Accession numberMIMAT0030437
IDbta-miR-2284ab
Stem-Loop bta-mir-2284ab
Sequence
uaaaaguuugguuggguuuuu
Get sequence
Deep sequencing1435 reads, 70 experiments
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).