Mature sequence bta-miR-2284ac

• Accession number: MIMAT0030447
• ID: bta-miR-2284ac
• Stem-Loop: bta-mir-2284ac
• Sequence: aaauguucgcuuggcuuuuucc
• Deep sequencing: 72 reads, 40 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-2284ac

References

1. PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).