Mature sequence bta-miR-2285af

Accession numberMIMAT0031057
IDbta-miR-2285af
Stem-Loop bta-mir-2285af-1 bta-mir-2285af-2
Sequence
gccaaaaagcuuguucagguu
Get sequence
Deep sequencing77 reads, 27 experiments
Predicted targets

References

1