Mature sequence stu-miR8041b-5p

Accession numberMIMAT0031222
IDstu-miR8041b-5p
Stem-Loop stu-MIR8041b
Sequence
gugcuuugcuauuuucauug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).