Mature sequence mmu-miR-142b

Accession numberMIMAT0031402
IDmmu-miR-142b
Stem-Loop mmu-mir-142b
Sequence
uccauaaaguaggaaacacu
Get sequence
Deep sequencing309 reads, 61 experiments
Predicted targets

References

1