Mature sequence bbe-let-7a-5p

Accession numberMIMAT0031568
IDbbe-let-7a-5p
Stem-Loop bbe-let-7a-1 bbe-let-7a-2
Sequence
ugagguaguagguuguauaguu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).