Mature sequence hbv-miR-B22-3p

Accession numberMIMAT0031773
IDhbv-miR-B22-3p
Stem-Loop hbv-mir-B22
Sequence
uaggggaguccgugagagagcgg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21543500 "Identification and expression analysis of herpes B virus-encoded small RNAs" Amen MA, Griffiths A J Virol. 85:7296-7311(2011).