Mature sequence dre-miR-221-5p

Accession numberMIMAT0031926
IDdre-miR-221-5p
Stem-Loop dre-mir-221
Sequence
accuggcauacaauguagauuucugu
Get sequence
Deep sequencing reads, experiments
Database links
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).