Mature sequence dre-miR-430a-4-5p

Accession numberMIMAT0031995
IDdre-miR-430a-4-5p
Stem-Loop dre-mir-430a-4
Sequence
acccucacaaaagcacugacu
Get sequence
Deep sequencing5258 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:15774722 "MicroRNAs regulate brain morphogenesis in zebrafish" Giraldez AJ, Cinalli RM, Glasner ME, Enright AJ, Thomson JM, Baskerville S, Hammond SM, Bartel DP, Schier AF Science. 308:833-838(2005).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).