Mature sequence rgl-miR7803b-3p

Accession numberMIMAT0032253
IDrgl-miR7803b-3p
Stem-Loop rgl-MIR7803b
Sequence
uacacgugucaaucaucuau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23861915 "Transcriptome/degradome-wide identification of R. glutinosa miRNAs and their targets: the role of miRNA activity in the replanting disease" Li MJ, Yang YH, Chen XJ, Wang FQ, Lin WX, Yi YJ, Zeng L, Yang SY, Zhang ZY PLoS One. 8:e68531(2013).