Mature sequence ssa-let-7f-5p

Accession numberMIMAT0032268
IDssa-let-7f-5p
Stem-Loop ssa-let-7f
Sequence
ugagguaguagauuguauuguu
Get sequence
Deep sequencing reads, experiments

References

1