Mature sequence ssa-let-7f-3p

Accession numberMIMAT0032269
IDssa-let-7f-3p
Stem-Loop ssa-let-7f
Sequence
cuauacaaucuauugccuuccc
Get sequence
Deep sequencing reads, experiments

References

1