Mature sequence str-miR-87a-3p

Accession numberMIMAT0033403
IDstr-miR-87a-3p
Stem-Loop str-mir-87a
Sequence
gugagcaagagcuuccggugug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).