Mature sequence pxy-miR-2a-5p

Accession numberMIMAT0033717
IDpxy-miR-2a-5p
Stem-Loop pxy-mir-2a
Sequence
gcagcaaagcggcugugacuuaug
Get sequence
Deep sequencing384 reads, 4 experiments

References

1