Mature sequence pxy-miR-8507-3p

Accession numberMIMAT0033725
IDpxy-miR-8507-3p
Stem-Loop pxy-mir-8507
Sequence
cagcauauccaaaaacucaucug
Get sequence
Deep sequencing125 reads, 4 experiments

References

1