Mature sequence pxy-miR-8517b

Accession numberMIMAT0033754
IDpxy-miR-8517b
Stem-Loop pxy-mir-8517b
Sequence
uaacuauugaacuguucugucaaa
Get sequence
Deep sequencing13 reads, 4 experiments

References

1