Mature sequence pxy-miR-8527

Accession numberMIMAT0033769
IDpxy-miR-8527
Stem-Loop pxy-mir-8527
Sequence
cuaugagaaagcacguaaca
Get sequence
Deep sequencing26 reads, 4 experiments

References

1