Mature sequence pxy-miR-8533

Accession numberMIMAT0033779
IDpxy-miR-8533
Stem-Loop pxy-mir-8533
Sequence
uucuagaggaucuugggcgcgc
Get sequence
Deep sequencing22 reads, 4 experiments

References

1