Mature sequence pxy-miR-306

Accession numberMIMAT0033787
IDpxy-miR-306
Stem-Loop pxy-mir-306-1 pxy-mir-306-2
Sequence
ccagguacuaggugacucuga
Get sequence
Deep sequencing622 reads, 4 experiments

References

1