Mature sequence atr-miR8551

Accession numberMIMAT0033822
IDatr-miR8551
Stem-Loop atr-MIR8551
Sequence
auguucuagguuagcucuuggaug
Get sequence
Deep sequencing489 reads, 2 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).