Mature sequence atr-miR8561.2

Accession numberMIMAT0033835
IDatr-miR8561.2
Stem-Loop atr-MIR8561
Sequence
aaugucacacauuaauuauggccu
Get sequence
Deep sequencing2648 reads, 3 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).