Mature sequence atr-miR8562c

Accession numberMIMAT0033838
IDatr-miR8562c
Stem-Loop atr-MIR8562c
Sequence
ucagaaugaucugaaauuuggagc
Get sequence
Deep sequencing4599 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).