Mature sequence atr-miR8564

Accession numberMIMAT0033840
IDatr-miR8564
Stem-Loop atr-MIR8564
Sequence
agcuguugggcucauauguucaua
Get sequence
Deep sequencing215 reads, 3 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).