Mature sequence atr-miR8565d

Accession numberMIMAT0033849
IDatr-miR8565d
Stem-Loop atr-MIR8565d
Sequence
uuuggcacagaucucuagaaaagu
Get sequence
Deep sequencing7304 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).