Mature sequence atr-miR8570

Accession numberMIMAT0033852
IDatr-miR8570
Stem-Loop atr-MIR8570
Sequence
aguugggagugcgucauugacuag
Get sequence
Deep sequencing869 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).