Mature sequence atr-miR8572

Accession numberMIMAT0033855
IDatr-miR8572
Stem-Loop atr-MIR8572
Sequence
ugacccggucguuggaauccucuc
Get sequence
Deep sequencing2358 reads, 2 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).