Mature sequence atr-miR8579

Accession numberMIMAT0033863
IDatr-miR8579
Stem-Loop atr-MIR8579
Sequence
gugauguagccccguuuaagaagg
Get sequence
Deep sequencing261 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).