Mature sequence atr-miR8552c

Accession numberMIMAT0033866
IDatr-miR8552c
Stem-Loop atr-MIR8552c
Sequence
ggccgugaucgucaaauuggcuca
Get sequence
Deep sequencing1338 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).