Mature sequence atr-miR8582

Accession numberMIMAT0033867
IDatr-miR8582
Stem-Loop atr-MIR8582
Sequence
uaggagucaugacguagcuug
Get sequence
Deep sequencing341 reads, 2 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).