Mature sequence atr-miR8588

Accession numberMIMAT0033875
IDatr-miR8588
Stem-Loop atr-MIR8588
Sequence
ccgagcucccaggguuaaugg
Get sequence
Deep sequencing3836 reads, 2 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).