Mature sequence atr-miR8590

Accession numberMIMAT0033877
IDatr-miR8590
Stem-Loop atr-MIR8590
Sequence
auuccgauuuguagaaaaaaaaau
Get sequence
Deep sequencing3763 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).