Mature sequence atr-miR8591

Accession numberMIMAT0033878
IDatr-miR8591
Stem-Loop atr-MIR8591
Sequence
aaggauguaagcucgaggccgagc
Get sequence
Deep sequencing3290 reads, 3 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).