Mature sequence atr-miR8593

Accession numberMIMAT0033880
IDatr-miR8593
Stem-Loop atr-MIR8593
Sequence
ucuuagcuuguccuaaaaggcaug
Get sequence
Deep sequencing77 reads, 2 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).