Mature sequence atr-miR8596

Accession numberMIMAT0033885
IDatr-miR8596
Stem-Loop atr-MIR8596
Sequence
aaauggauuucaagcucuaaaaau
Get sequence
Deep sequencing915 reads, 3 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).