Mature sequence atr-miR8601

Accession numberMIMAT0033890
IDatr-miR8601
Stem-Loop atr-MIR8601
Sequence
ugcgauuagguguuggaguuu
Get sequence
Deep sequencing97 reads, 2 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).