Mature sequence atr-miR8602

Accession numberMIMAT0033891
IDatr-miR8602
Stem-Loop atr-MIR8602
Sequence
ucaggagagaugaugccggcc
Get sequence
Deep sequencing11716 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).