Mature sequence atr-miR8607

Accession numberMIMAT0033896
IDatr-miR8607
Stem-Loop atr-MIR8607
Sequence
uuuguaauucuagaucucaggcuc
Get sequence
Deep sequencing2089 reads, 2 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).