Mature sequence atr-miR2111

Accession numberMIMAT0033897
IDatr-miR2111
Stem-Loop atr-MIR2111
Sequence
uaaucuguaucuugagguuugg
Get sequence
Deep sequencing7294 reads, 2 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).