Mature sequence atr-miR156c

Accession numberMIMAT0033909
IDatr-miR156c
Stem-Loop atr-MIR156c
Sequence
uugacagaagauagagagcac
Get sequence
Deep sequencing3210 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).