Mature sequence atr-miR164b

Accession numberMIMAT0033914
IDatr-miR164b
Stem-Loop atr-MIR164b
Sequence
uggagaagcagggcacgugca
Get sequence
Deep sequencing2479 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).