Mature sequence atr-miR166b

Accession numberMIMAT0033916
IDatr-miR166b
Stem-Loop atr-MIR166b
Sequence
ucucggaccaggcuucauucc
Get sequence
Deep sequencing579846 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).