Mature sequence atr-miR169a

Accession numberMIMAT0033921
IDatr-miR169a
Stem-Loop atr-MIR169a
Sequence
uagccaaggaugacuugccu
Get sequence
Deep sequencing229 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).